View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7475_high_7 (Length: 237)
Name: NF7475_high_7
Description: NF7475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7475_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 63 - 224
Target Start/End: Original strand, 36946753 - 36946914
Alignment:
| Q |
63 |
tgtaaagttattaatcttttcgtttataactatattcaagtccgttttttctgtaggctaagcaagtactggctaaaaggagataaagctggagctttag |
162 |
Q |
| |
|
|||||||||||||| |||||| ||||| ||||||||||||||| ||||||||||||| || ||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
36946753 |
tgtaaagttattaaacttttcatttattactatattcaagtcccttttttctgtaggttatgcaagtattggctaaaaggagataaagctggaactttag |
36946852 |
T |
 |
| Q |
163 |
aaatcttagcaatcctacctggttttgctgacaatgtgagagtcaacgaaaatggtgacttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36946853 |
aaatcttagcaatcctacctggttttgccgacaatgtgagagtcaacgaaaatggtgacttt |
36946914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 36946613 - 36946669
Alignment:
| Q |
1 |
tttacaaagacgtccaacatattttgccattctgacacaatatgtttagaaagtaat |
57 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36946613 |
tttacaaagacgttcaaaatattttcccattctgacacaatatgtttagaaagtaat |
36946669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University