View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7475_low_13 (Length: 256)
Name: NF7475_low_13
Description: NF7475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7475_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 34214545 - 34214325
Alignment:
| Q |
19 |
attcatatgattttaatcatctaatttttaaatgaaaaaggttaacaagtactcttcaattattagttaagaaaacaaatatgaatatatgaaaattaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34214545 |
attcatatgattttaatcatctaatttttaaatgaaaaaggttaacacgtactcttcaattattagttaagaaaaaaaatatgaatatatgaaaattaat |
34214446 |
T |
 |
| Q |
119 |
ttggaacgtgtgtagttaaaatcataaaagagtaaaaaatgttattttcaattcaaacgtactttctttgtttcaatatctacggttttaaaggtactag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34214445 |
ttggaacgtgtgtagttaaaatcataaaagagtaaaaaatgttattttcaattcaaacgtactttctttgtttcaatatctacggttttaaaggtactag |
34214346 |
T |
 |
| Q |
219 |
taatccaatttcaaaagtttt |
239 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
34214345 |
taatccaatttcacaagtttt |
34214325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University