View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7475_low_16 (Length: 232)

Name: NF7475_low_16
Description: NF7475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7475_low_16
NF7475_low_16
[»] chr1 (1 HSPs)
chr1 (1-211)||(33150199-33150410)
[»] chr2 (1 HSPs)
chr2 (113-175)||(29927818-29927880)
[»] chr3 (1 HSPs)
chr3 (114-174)||(1699932-1699992)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 33150199 - 33150410
Alignment:
1 tattaatattgtacccgttttttcttcttttgttatgatcaatttgtttt-gggttgtctaacatccaccagcaaagaactagcaagtcgatgggccatt 99  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
33150199 tattaatattgtacccgtttttccttcttttattatgatcaatttgttttagggttgtctaacatccaccagcaaagaactagcaagtcgatgggccatt 33150298  T
100 aaaattggtaattggaaaattgcatttcacaatttacactatgctaagaaatactatgaaatgacaaatttaacccgcagttaactatcatcggttaaaa 199  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||    
33150299 aaaattggtaattggaaaattgcatttcacaatttacacgatgctaagaaacactataaaatgacaaatttaacctgcagttaactatcatcggttaaaa 33150398  T
200 tatattgacagt 211  Q
    ||||||| ||||    
33150399 tatattggcagt 33150410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 175
Target Start/End: Complemental strand, 29927880 - 29927818
Alignment:
113 ggaaaattgcatttcacaatttacactatgctaagaaatactatgaaatgacaaatttaaccc 175  Q
    |||||||||| ||||||| || |||| ||||||| || ||| ||||||||| |||||||||||    
29927880 ggaaaattgcctttcacacttcacacaatgctaaaaattaccatgaaatgataaatttaaccc 29927818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 1699932 - 1699992
Alignment:
114 gaaaattgcatttcacaatttacactatgctaagaaatactatgaaatgacaaatttaacc 174  Q
    ||||||||  ||||||| || |||| ||||||||||| || ||||||| ||||||||||||    
1699932 gaaaattgtctttcacacttcacacaatgctaagaaacaccatgaaataacaaatttaacc 1699992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University