View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_high_19 (Length: 228)
Name: NF7477_high_19
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_high_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 41 - 228
Target Start/End: Original strand, 2247903 - 2248089
Alignment:
| Q |
41 |
caattaattttgcccaatgttgagaagaagatataaatttctattaacaagtctttcccttttttacagcaaagccacaattgtgtgcactcaaatttca |
140 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2247903 |
caattaattttgcccaatgttgagaataagatagaaatttctatta-caagtctttcccttttttacaacaaagccacaattgtgtgcactcaaatttca |
2248001 |
T |
|
| Q |
141 |
caaattataacaatcctcttctattgcattgcatcctcctattaattatggaaacaattagccaactgctctaattgtcacttactga |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2248002 |
caaatcataacaatcctcttctattgcattgcatcctcctattaattatggaaacaattagccaactactctaattgtcacttactga |
2248089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University