View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7477_high_23 (Length: 217)

Name: NF7477_high_23
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7477_high_23
NF7477_high_23
[»] chr3 (1 HSPs)
chr3 (13-201)||(55173089-55173277)
[»] chr4 (1 HSPs)
chr4 (23-101)||(27721937-27722015)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 55173277 - 55173089
Alignment:
13 agtatcatagagatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaattgctaatatt 112  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55173277 agtatcacagagatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaattgctaatatt 55173178  T
113 atgtactaatgtagcaaactaactcaattgaatgtgaaattaactatgaatgaattgcagtaccatggtggaacaaactttggaagaac 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55173177 atgtactaatgtagcaaactaactcaattgaatgtgaaattaactatgaatgaattgcagtaccatggtggaacaaactttggaagaac 55173089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 27721937 - 27722015
Alignment:
23 agatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaa 101  Q
    |||||||| ||||| ||||||||||||||||| || |||||||| ||  |||||  | | |||||||||||||||||||    
27721937 agatctgcagaagacattgccttctcagttgctcgcttcttctctaagcatggatctttagtcaactactatatggtaa 27722015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University