View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_low_14 (Length: 282)
Name: NF7477_low_14
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 45 - 269
Target Start/End: Complemental strand, 50352810 - 50352586
Alignment:
| Q |
45 |
gtggaactcagttctaaaaagtatctctgtggagtgttgccttactcgcgtaagattgtcgcaaaagtatttccttgggggagaaagagaagcacatgtt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50352810 |
gtggaactcagttctaaaaagtatctctgtggagtgttgccttactcgcgtaagattgtcgcaaaagtatttccttggaggagaaagagaagcacatgtt |
50352711 |
T |
|
| Q |
145 |
tttcatgtgtaatgccgcaaatgaggtgtggaaagaggtggattatgggaaaccatcaaaccnnnnnnnatttagaggttagaacttagatcgtttcaac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50352710 |
tttcatgtgtaatgccgcaaatgaggtgcggaaagaggtggattatgggaaaccatcaaacctttttttatttagaggttagaacttagatcgtttcaac |
50352611 |
T |
|
| Q |
245 |
caatctgtttttgcaatgatgtcca |
269 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
50352610 |
caatctgtttttgcaatgatgtcca |
50352586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University