View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_low_17 (Length: 251)
Name: NF7477_low_17
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 41770968 - 41771191
Alignment:
| Q |
18 |
tatactgctgagaaggctgtagaagctaaggataccaccgtggggaagcttggagagttgaaggattcagctgcagatgctgctaagagagctatgggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41770968 |
tatactgctgagaaggctgtagaagctaaggataccaccgtggggaagcttggagagttgaaggattcagctgcagatgctgctaagagagctatgggtt |
41771067 |
T |
|
| Q |
118 |
tcttgactggcaagaaagatgaaactaaggagaagacaaaggtttgttgcctaaaattttcaacactttaattaggtcaattt-aataatttcatttttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41771068 |
tcttgactggcaagaaagatgaaactaaggagaagacaagggtttgttgcctaaaattctcaacactttaattaggtcaatttaaataatttcatttttg |
41771167 |
T |
|
| Q |
217 |
tgaatgtgaaattgtcgtgtgtgc |
240 |
Q |
| |
|
||||||||||||||| |||||||| |
|
|
| T |
41771168 |
tgaatgtgaaattgtggtgtgtgc |
41771191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University