View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_low_23 (Length: 217)
Name: NF7477_low_23
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 36133412 - 36133236
Alignment:
| Q |
18 |
atgaagaccggtgaattgtggcagacttgtaacttaagtttggcgtaactcaactcttataaaatcgacaataaaattgtatttatttataaacaatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36133412 |
atgaagaccggtgaattgtggcagacttgtaacttaagtttggcgtaactcaactcttataaaatcgacaataaaattgtatttatttataaacaatttt |
36133313 |
T |
 |
| Q |
118 |
caaagatttatgattaatcgtaagagttcaaaacacatattctcgtgcttaaaattggacattttaaatgtgatttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
36133312 |
taaagatttatgattaatcgtaagagttcaaaacacatcttctcgcgcttaaaattagacatttcaaatgtgatttg |
36133236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University