View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_low_24 (Length: 217)
Name: NF7477_low_24
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 201
Target Start/End: Complemental strand, 55173277 - 55173089
Alignment:
| Q |
13 |
agtatcatagagatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaattgctaatatt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173277 |
agtatcacagagatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaattgctaatatt |
55173178 |
T |
 |
| Q |
113 |
atgtactaatgtagcaaactaactcaattgaatgtgaaattaactatgaatgaattgcagtaccatggtggaacaaactttggaagaac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173177 |
atgtactaatgtagcaaactaactcaattgaatgtgaaattaactatgaatgaattgcagtaccatggtggaacaaactttggaagaac |
55173089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 27721937 - 27722015
Alignment:
| Q |
23 |
agatctgctgaagatattgccttctcagttgcccgattcttctccaaaaatggaaatctggtcaactactatatggtaa |
101 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| || |||||||| || ||||| | | ||||||||||||||||||| |
|
|
| T |
27721937 |
agatctgcagaagacattgccttctcagttgctcgcttcttctctaagcatggatctttagtcaactactatatggtaa |
27722015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University