View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7477_low_26 (Length: 210)

Name: NF7477_low_26
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7477_low_26
NF7477_low_26
[»] chr1 (1 HSPs)
chr1 (1-196)||(50352413-50352608)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 50352608 - 50352413
Alignment:
1 atctgtttttgcaatgatgtccagcagaacaacggagtgaccatgactatatggagcctttggtgccaaggaattgggtcatttgggaagacaccatcaa 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50352608 atctgtttttgcaatgatgtccagctgaacaacggagtgaccatgactatatggagcctttggtgccaaggaattgggtcatttgggaagacaccatcaa 50352509  T
101 gaactgctgttttgaagtatactgtcgtgcgatatcgaccttggaggactggaaaatcttcaaatttgagaccttggtcctgccactcacacaggt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
50352508 gaactgctgttttgaagtatactgtcgtgcgatatcgaccttggaggactggaaaatcttcaaatttgagaccttggtcctgccactcacaaaggt 50352413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University