View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7477_low_26 (Length: 210)
Name: NF7477_low_26
Description: NF7477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7477_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 50352608 - 50352413
Alignment:
| Q |
1 |
atctgtttttgcaatgatgtccagcagaacaacggagtgaccatgactatatggagcctttggtgccaaggaattgggtcatttgggaagacaccatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50352608 |
atctgtttttgcaatgatgtccagctgaacaacggagtgaccatgactatatggagcctttggtgccaaggaattgggtcatttgggaagacaccatcaa |
50352509 |
T |
 |
| Q |
101 |
gaactgctgttttgaagtatactgtcgtgcgatatcgaccttggaggactggaaaatcttcaaatttgagaccttggtcctgccactcacacaggt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50352508 |
gaactgctgttttgaagtatactgtcgtgcgatatcgaccttggaggactggaaaatcttcaaatttgagaccttggtcctgccactcacaaaggt |
50352413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University