View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7480_high_7 (Length: 250)
Name: NF7480_high_7
Description: NF7480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7480_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 2879397 - 2879159
Alignment:
| Q |
1 |
ccaagtatttattgatagcttgggccgggtacgatctcggcccatgtttaccaataagcctaacagtggaattgtagtaaacagctgaagtcaaaagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2879397 |
ccaagtatttattgatagcttgggtcgggtacgatctcggcccatgtttaccgataagcctaacagtggaattgtagtaaacagctgaagtcaaaagcaa |
2879298 |
T |
|
| Q |
101 |
acgtggttttctcctaaccttagcttcagcaaacaaagcattataccattcctcgtacaacaaaccaaggttaaacatgtcttgttgagtttcaggaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2879297 |
acgtggttttctcctaaccttagcttcagcaaacaaagcattataccattcctcgtacaacaaaccaaggttaaacatgtcttgttgagtttcaggaaat |
2879198 |
T |
|
| Q |
201 |
tcccaatccaagtcaacaccatcaaatctatattttctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2879197 |
tcccaatccaagtcaacaccatcaaacctatattttctt |
2879159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University