View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7481_low_25 (Length: 217)
Name: NF7481_low_25
Description: NF7481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7481_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 32024807 - 32024990
Alignment:
| Q |
16 |
gaagacaaaccaaacatacacttagtttgttcgttgacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024807 |
gaagacaaaccaaacatacacttagtttgtt----gacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttgaactgtgt |
32024902 |
T |
|
| Q |
116 |
gattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024903 |
gattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgt |
32024990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 85 - 170
Target Start/End: Original strand, 32026304 - 32026389
Alignment:
| Q |
85 |
atatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttcta |
170 |
Q |
| |
|
|||||||| |||||||||| || || ||| ||| |||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32026304 |
atatgtgaatctcttttggatttaagtgtatgagtaaatgaaattttgatgatctgtgtgtttgacttcattttggttgttttcta |
32026389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University