View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7483_high_15 (Length: 268)
Name: NF7483_high_15
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7483_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 29 - 252
Target Start/End: Complemental strand, 25333207 - 25332984
Alignment:
| Q |
29 |
gtggtaagaagggagtgtgaaagtgaaggtaggtttgatgtcaaggtggaaggaggaaaaagaatgatttggagggggtggaacctcacatgattttann |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25333207 |
gtggtaagaagggagtgtgaaagtgaaggtaggtttgatgtcgaggtggaaggaggaaaaagaatgatttggagggggtggaacctcacatgattttatt |
25333108 |
T |
 |
| Q |
129 |
nnnnnnaattcaaattctacactgtctaacacttgaagttgccacattattcaagttagtcatgtacactagcaaatgcaaaatgggtaaactttgtggg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25333107 |
ttttttaattcaaattctacactgtctaacacttgaagttgccacattattcaagttagtcatgtagactagcaaatgcaaaatgggtaaactttgtggg |
25333008 |
T |
 |
| Q |
229 |
ttgagatcaatcaattgaaactta |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25333007 |
ttgagatcaatcaattgaaactta |
25332984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University