View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7483_high_17 (Length: 248)
Name: NF7483_high_17
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7483_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 2 - 220
Target Start/End: Complemental strand, 7309975 - 7309764
Alignment:
| Q |
2 |
cgtctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagcgacaagcatgaatgatgga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7309975 |
cgtctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagc-------atgaatgatgga |
7309883 |
T |
|
| Q |
102 |
acatggcggcagaatgttatgaagaaaaatattgcagcttattggaacttgtttgtttattgtactaattttacagagcctattttcacccgagctaaaa |
201 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7309882 |
acatggcggcagaatgctatgaagcaaaatattgcagctttttggaacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaa |
7309783 |
T |
|
| Q |
202 |
ctccattgctatttatgag |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7309782 |
ctccattgctatttatgag |
7309764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 92 - 206
Target Start/End: Original strand, 7330063 - 7330181
Alignment:
| Q |
92 |
gaatgatggaacatggcggcagaatgttatgaagaaaaatattgcagcttattgg------aacttgtttgtttattgtactaattttacagagcctatt |
185 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| | || ||||| |
|
|
| T |
7330063 |
gaatgatggagcatggctgcggaatgctatgaagaaaaatattggagcttattggaactacaacttgtttggttattgtactcatttt--atagtctatt |
7330160 |
T |
|
| Q |
186 |
ttcacccgagctaaaactcca |
206 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7330161 |
ttcacccgagctaaaactcca |
7330181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 7330012 - 7330056
Alignment:
| Q |
20 |
tattgttgaaattggttcattttgaattgtagatctacaacctga |
64 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7330012 |
tattgtttaaatgggttcattttgaattgtagatctacaacctga |
7330056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University