View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7483_low_15 (Length: 280)
Name: NF7483_low_15
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7483_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 3185792 - 3185999
Alignment:
| Q |
23 |
aagctcataattaagttggttaatttttcacttttgaataaacaaaagacagccatgtatatataaatatgcaaggagatggaaataaagtaaggttgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3185792 |
aagctcataattaagttggttaatttttcacttttgaataaacaaaagacagccatgtatatataaatatgcaaggagatggaaataaagtaaggttgaa |
3185891 |
T |
|
| Q |
123 |
gttaagtaacaaaaaataataattttatgatgatgttctcaattggcttttagctctagtttataataaaattagttagcatataactaatttgtggtta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3185892 |
gttaagtaacaaaaaataataattttatgacgatgttctcaattggcttttagctctagtttataataaaattagttagcatataactaatttgtggtta |
3185991 |
T |
|
| Q |
223 |
aatgttaa |
230 |
Q |
| |
|
|||||||| |
|
|
| T |
3185992 |
aatgttaa |
3185999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University