View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7483_low_19 (Length: 250)
Name: NF7483_low_19
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7483_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 13887136 - 13887235
Alignment:
| Q |
1 |
gctccacatatcactagacactttgtattcatttcaacaatatctggcatatgcaagtgttcaatgtgtcttcaaactccttctttcaatgcagttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887136 |
gctccacatatcactagacactttgtattcatttcaacaatatctggcatatgcaagtgttcaacgtgtcttcaaactccttctttcaatgcagttttta |
13887235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 13887395 - 13887444
Alignment:
| Q |
187 |
ctcagtggatagaattacattcattagatgttttccttgcttttcatgatat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
13887395 |
ctcagtggatagaattacattcattagatg--ttcttggcttttcatgatat |
13887444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University