View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7483_low_19 (Length: 250)

Name: NF7483_low_19
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7483_low_19
NF7483_low_19
[»] chr3 (2 HSPs)
chr3 (1-100)||(13887136-13887235)
chr3 (187-238)||(13887395-13887444)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 13887136 - 13887235
Alignment:
1 gctccacatatcactagacactttgtattcatttcaacaatatctggcatatgcaagtgttcaatgtgtcttcaaactccttctttcaatgcagttttta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
13887136 gctccacatatcactagacactttgtattcatttcaacaatatctggcatatgcaagtgttcaacgtgtcttcaaactccttctttcaatgcagttttta 13887235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 13887395 - 13887444
Alignment:
187 ctcagtggatagaattacattcattagatgttttccttgcttttcatgatat 238  Q
    ||||||||||||||||||||||||||||||  ||| | ||||||||||||||    
13887395 ctcagtggatagaattacattcattagatg--ttcttggcttttcatgatat 13887444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University