View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7483_low_6 (Length: 392)
Name: NF7483_low_6
Description: NF7483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7483_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 9e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 200 - 374
Target Start/End: Original strand, 12157320 - 12157493
Alignment:
| Q |
200 |
cacgcacacgtacgtaaattaaactcttaatcaaactatatatttatagaaacaaaccttgactgcttctgaacagattctaggaagagatcagcataat |
299 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||| |||||||||||||||| |||||| |||| |||| || |
|
|
| T |
12157320 |
cacgcacacgtacgtaaattaatctcttaatcaaactatatatttatagaaatgaacattgattgcttctgaacagattttaggaaaagattggcat-at |
12157418 |
T |
|
| Q |
300 |
ctttaaacgatgtaataggaatcgtggttccatttaattcaaccttagtcgtctttccgaggaaccctgccatgt |
374 |
Q |
| |
|
| | |||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||| ||||| ||||| |
|
|
| T |
12157419 |
atgtgaacgatgtaataggaatcttggttccatttaattcaaccttaatcgtccttccgaggatccctgtcatgt |
12157493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 12157050 - 12157172
Alignment:
| Q |
17 |
acatcaatgacctccaagttactataattcaaaagctcactagctagtcacctgttgaaactgcttctcacttggactcacgacaatctcccacccatta |
116 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |||| |||| || | |
|
|
| T |
12157050 |
acatcaatgaccttcaagttggtataattcaaaagctcactagctagtcagctgttgaaactacctctcacttggactcacgactatcttgcacctatca |
12157149 |
T |
|
| Q |
117 |
cttcctttggcataaatcctaat |
139 |
Q |
| |
|
||| ||||| ||||||||||||| |
|
|
| T |
12157150 |
cttactttgacataaatcctaat |
12157172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University