View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7485_low_2 (Length: 254)
Name: NF7485_low_2
Description: NF7485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7485_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 12185658 - 12185427
Alignment:
| Q |
17 |
atgcagaactattatctccccatgtagaagtaaatttcaaaaccatatatgcaagcattccatgtggagtaaattctcttggaaaaccagcaggtttaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12185658 |
atgcagaactattatctccccatgtagaagtaaatttcaaaaccatatatgcaagcattccatgtggagtaaattctcttggaaaaccagcaggtttaca |
12185559 |
T |
|
| Q |
117 |
ggtccatcttccgtcgtcacccaccatatattccactagtttttgattaact---ctcaactgtctcttctgacccnnnnnnntaaaatcaaccatgtct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12185558 |
ggtccatcttccgtcgtcacccaccatatattccactagtttttgattaactgaactcaactgtctcttctgacccaaaaaaataaaatcaaccatgtct |
12185459 |
T |
|
| Q |
214 |
attgtctcccacatgccacagcaaagaacacc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12185458 |
attgtctcccacatgccacagcaaagaacacc |
12185427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University