View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7486_high_13 (Length: 222)
Name: NF7486_high_13
Description: NF7486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7486_high_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 48483550 - 48483769
Alignment:
| Q |
2 |
gccaaaggaaacttatgaacacatcataaatttataagttcatccaaacacgactataagttcttatgttataaaataatcacaaataagctttcaaaaa |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483550 |
gccaaaggcaacttatgaacacatcataaatttataagttcatccaaacacgactataagttcttatgttataaaataatcacaaataagctttcaaaaa |
48483649 |
T |
 |
| Q |
102 |
gctcgtcaagatatcccaaaacatatttgtatgaggcatacaggtgaagttctccataactatgaaagtgagctaaattgattacatgcatagattggtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483650 |
gctcgtcaagatatcccaaaacatatttgtatgaggcatacaggtgaa-ttctccataactatgaaagtgagctaaattgattacatgcatagattggtt |
48483748 |
T |
 |
| Q |
202 |
agtacgtgattgagtcaagcc |
222 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
48483749 |
agtacgtgatcgagtcaagcc |
48483769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University