View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7488_high_2 (Length: 241)
Name: NF7488_high_2
Description: NF7488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7488_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 4310960 - 4311132
Alignment:
| Q |
1 |
atttgtttccaaaatttgattcaagtagtctaatccaaagacaattacagaaattggtttcacaagacccttnnnnnnnnnctacgagtgtaactagaac |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4310960 |
atttgtctccaaaatttgattcaagtagtctaatccaaagacaattacagaaattggtttcacaagacccttaaaagaaaactacgagtgtaactagaac |
4311059 |
T |
 |
| Q |
101 |
tagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4311060 |
tagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa |
4311132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University