View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7488_high_4 (Length: 205)
Name: NF7488_high_4
Description: NF7488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7488_high_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 14138024 - 14137841
Alignment:
| Q |
13 |
aatatcagaagtaacatttgcagaagaagatgaaggtttcatgttcatgttcatgttgatggaagatgaaggtttgttcttgttattcttctttggtaga |
112 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14138024 |
aatatcagaagtaacattagcagaaga---tgaaggtttcatgttcatgtt------gatggaagatgaaggtttgttcttgttattcttctttggtaga |
14137934 |
T |
 |
| Q |
113 |
agaaaagggatgcgtgaacggctatgatggtcatgtttggttgaagtttgagggacaatgatggaactaagagaagaagatgaagaagatgga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14137933 |
agaaaagggatgcgtgaacggctatgatggtcatgtttggttgaagtttgaggtacaatgatggaactaagagaagaagatgaagaagatgga |
14137841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University