View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7488_low_1 (Length: 413)
Name: NF7488_low_1
Description: NF7488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7488_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 18 - 395
Target Start/End: Complemental strand, 35478654 - 35478283
Alignment:
| Q |
18 |
cttgcatcagcatcaaatgaatacactctcattcgtgtggtaattcacttattgtgaagccaagcaagcacaaaattccttttcttgcacatggttattg |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35478654 |
cttgcatcggcatcaaatgaatacactctcattcgtgtggtaattcacttattgtgaagccaagcaagcacaaaattccttttcttgcacatggttattg |
35478555 |
T |
|
| Q |
118 |
agctagatatcgaaattgcaaaactcttttatgtatagccacccaaaattccttttccattggcatatagtgttgtaaaatctttacagacaagagctag |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35478554 |
agctaaatatcgaaattgcaaaactcttttatgtatagccacccaaaattccttttccattggc--atagtgttgtaaaatctttacagacaagagctag |
35478457 |
T |
|
| Q |
218 |
actaggatgcaaattcaagccatctagcacatatatatgtaacaaccctcatgccagaagaatttcctatttcatgcacatgattatattcgggactcaa |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35478456 |
actaggatgcaagttcaagccatctagcac----atatgtaacaaccctcatgccagaagaatttcctatttcatgcacatgattatattcgggactcaa |
35478361 |
T |
|
| Q |
318 |
tatatctgcattattcaaggcaagaattacgaagctaacaacttgcaacatgttcttccttccgcttttgttgccatc |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35478360 |
tatatctgcattattcaaggcaagaattacgaagctaacaacttccaacatgttcttccttccgcttttgttgccatc |
35478283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University