View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_high_26 (Length: 297)
Name: NF7489_high_26
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 32853079 - 32852806
Alignment:
| Q |
1 |
atattcaatcacttggttatggagacccaaaaaatctaaaaactgannnnnnnn-cttcttataataaggaccaggaagtattgtatttgaccataagtt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32853079 |
atattcaatcacttggttatggagacccaaaaaatctaaaaactgatttttttttcttcttataataaggacgaggaagtattgtatttgaccataagtt |
32852980 |
T |
 |
| Q |
100 |
taggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcagttttgctttta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852979 |
taggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcagttttgctttta |
32852880 |
T |
 |
| Q |
200 |
ataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852879 |
ataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaa |
32852806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University