View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_high_27 (Length: 293)
Name: NF7489_high_27
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 281
Target Start/End: Original strand, 44108072 - 44108366
Alignment:
| Q |
3 |
gttcttctgcagttttcaaatgattcaatttttgttcttaatattt-ttctaatttttgtgcttcgattgtgttgttgttctcgaatctcaatcggttat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44108072 |
gttcttctgcagttttcaaatgattcaatttttgttcttaatttttattctaatttctgtgctacgattgtgttgttgttctcgaatctcaattggttat |
44108171 |
T |
|
| Q |
102 |
tatacaattgttaatataatattgtcatttgaaaatctaatttcccccaaacacattca--------------tcttttgc-ttcaatttctttcatttt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
44108172 |
tatacaattgttaatataatattgtcatttcaaaatctaatttcccccaaacacattcatctatgctttaatttcttttgcgttcaatttcttgaatttt |
44108271 |
T |
|
| Q |
187 |
gcttattcatctattgttgttctcgatcagttcttttggttattcatccttcaaatcattcaatttttctgattttgtgcttcaatattgatatt |
281 |
Q |
| |
|
| |||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44108272 |
ggttattcatctgttgttcttctcgatcagttcttttgcttattcatccttcaaatcattcaatttttctgattttgtgcttcaatgttgatatt |
44108366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University