View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_high_35 (Length: 248)
Name: NF7489_high_35
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 34384957 - 34385188
Alignment:
| Q |
1 |
taggtacagttacatgaaaatgcacattatagtactagtactgcgtacctttgaatgccctcttttattccttgtggatttacttgagtgtagaatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384957 |
taggtacagttacatgaaaatgcacattatagtactagtactacgtacctttgaatgccctcttttattccttgtggatttacttgagtgtagaatgcat |
34385056 |
T |
|
| Q |
101 |
cccaagtgcaccatccaaacaaatcaagatgtacaggaatttccttgttttcaagatgacagaaagttcctttgtgtttctctaatatcctatgtcatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34385057 |
cccaagtgcaccatccaaacaaatcaagatgtacaggaatttccttgttttcaagatgacagaaagttcctttgtgtttctctaatatcctatgtcatta |
34385156 |
T |
|
| Q |
201 |
gaaatgaaaatggatatgaaatacgtgcttaa |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
34385157 |
gaaatgaaaatggatatgaaatatgtgcttaa |
34385188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 36 - 157
Target Start/End: Complemental strand, 27785523 - 27785402
Alignment:
| Q |
36 |
tagtactgcgtacctttgaatgccctcttttattccttgtggatttacttgagtgtagaatgcatcccaagtgcaccatccaaacaaatcaagatgtaca |
135 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||| ||||||||||||||||| | |||| ||| | ||||| ||||||||||||||| ||| ||||| | | |
|
|
| T |
27785523 |
tagtactaggtacccttggatgccctcttttactccttgtggatttactttattgtaaaattcttcccatgtgcaccatccaaaccaatacagatgcaga |
27785424 |
T |
|
| Q |
136 |
ggaatttccttgttttcaagat |
157 |
Q |
| |
|
|| | |||||||||||||||| |
|
|
| T |
27785423 |
cgagtctccttgttttcaagat |
27785402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University