View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_high_40 (Length: 228)
Name: NF7489_high_40
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 39878422 - 39878225
Alignment:
| Q |
14 |
gtttggagtttagttgattggatctgtagaatcatcatattggtcatatgaatttgtgtttttcttgtattaagattgtttt-gtaccaacttttaccta |
112 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39878422 |
gtttgaagtttagttgataggatctgtagaattatcgtattggtcatatgaatttgtgtttttcttgtattatgattgtttttgtaccaacttttaccta |
39878323 |
T |
 |
| Q |
113 |
gagttttataatgcaataatattctttatttttataggctattgccacaggcaatctgtaccgctcaaaagttgcatcgatgctctggaggccacacg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39878322 |
gagttttataatgcaataatattctttatttttataggctattgccacaggcaatctgtaccgctcaaaagttgcatcgatgctccggaggccacacg |
39878225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University