View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_low_24 (Length: 353)
Name: NF7489_low_24
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 334
Target Start/End: Complemental strand, 32521201 - 32520868
Alignment:
| Q |
1 |
gataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttattattgcaggtaacaggtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32521201 |
gataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttattattgatggtaacaggtttt |
32521102 |
T |
|
| Q |
101 |
gtatcaagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcggaggagttacatcaattaaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32521101 |
gtatcaagttagtggaagaatggagttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcggaggagttacatcaattaaa |
32521002 |
T |
|
| Q |
201 |
aaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtgcaaatgaggtcaagaaaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32521001 |
aaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtgcacatgaggtcaagaaaaat |
32520902 |
T |
|
| Q |
301 |
gatatggttaattcaaatgtttcggtgtcggatc |
334 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
32520901 |
gatacggttaattcaaatgtttcggtgtcggatc |
32520868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 52348690 - 52348411
Alignment:
| Q |
1 |
gataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttattattgcaggtaacaggtttt |
100 |
Q |
| |
|
||||||||||| | |||||||| | ||||||||||| | || ||||||||||||||||||||||| |||| |||||||||| ||||||| ||||| |
|
|
| T |
52348690 |
gataaagctcgcctagattttgctcgaattcttgtatcaattcaaaatattgaaattgtgaatcagtcccttgattttattattgatggtaacaagtttt |
52348591 |
T |
|
| Q |
101 |
gtatcaagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcggaggagttacatcaattaaa |
200 |
Q |
| |
|
||| ||||| ||||| ||| |||| |||||||||||||| ||||||||| | |||||||||||| ||| |||| |||| || || |||| ||| |
|
|
| T |
52348590 |
ttattaagttggtggaggaacggggatgtaatttgggagaagatgcttttttatcggaagtggaacttgtatctaacgcggaagaattttttcaacaaaa |
52348491 |
T |
|
| Q |
201 |
aaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtg |
280 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
52348490 |
aaatgatgtggaattggatgaggttcaaggggaatgggaattggatgatttagtgtcggacttgcataaggaatggagtg |
52348411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 215 - 266
Target Start/End: Complemental strand, 12964751 - 12964700
Alignment:
| Q |
215 |
tggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgca |
266 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | | || ||||||||||| |
|
|
| T |
12964751 |
tggatgaggttcaaggtgaatgggaattggatgctctagttaatgatttgca |
12964700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 279
Target Start/End: Original strand, 2890913 - 2890977
Alignment:
| Q |
215 |
tggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagt |
279 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | || ||||||||||| || ||||||||| |
|
|
| T |
2890913 |
tggatgaggttcaaggggaatgggagttggatgatcttgttaatgatttgcacaaagaatggagt |
2890977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 213 - 277
Target Start/End: Complemental strand, 48783606 - 48783542
Alignment:
| Q |
213 |
tttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatgga |
277 |
Q |
| |
|
|||||| ||||| |||||||| ||||| ||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
48783606 |
tttggaggaggtccaaggggagtgggagttggatgatcttgtgaatgatttgcataaggagtgga |
48783542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 217 - 279
Target Start/End: Original strand, 13059816 - 13059878
Alignment:
| Q |
217 |
gatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || |||||||||| || ||||||||| |
|
|
| T |
13059816 |
gatgaggttcaaggggaatgggaattggatgaccttgttcatgatttgcaaaatgaatggagt |
13059878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 48783707 - 48783655
Alignment:
| Q |
112 |
gtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtgga |
164 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||||| |||| |||||||| |
|
|
| T |
48783707 |
gtggaagaatgggggtgtcatttgggggaggatgcttttttgactgaagtgga |
48783655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 21110757 - 21110705
Alignment:
| Q |
106 |
aagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacgga |
158 |
Q |
| |
|
||||| ||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
21110757 |
aagttggtggaggagtggggttgtaatttgggggaggatgctttcatgacgga |
21110705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 21309186 - 21309230
Alignment:
| Q |
106 |
aagttagtggaagaatggggttgtaatttgggagaggatgctttt |
150 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
21309186 |
aagttggtggaggaatgggggtgtaatttgggggaggatgctttt |
21309230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University