View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7489_low_31 (Length: 297)

Name: NF7489_low_31
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7489_low_31
NF7489_low_31
[»] chr2 (1 HSPs)
chr2 (1-273)||(32852806-32853079)


Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 32853079 - 32852806
Alignment:
1 atattcaatcacttggttatggagacccaaaaaatctaaaaactgannnnnnnn-cttcttataataaggaccaggaagtattgtatttgaccataagtt 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||| |||||||||||||||||||||||||||    
32853079 atattcaatcacttggttatggagacccaaaaaatctaaaaactgatttttttttcttcttataataaggacgaggaagtattgtatttgaccataagtt 32852980  T
100 taggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcagttttgctttta 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32852979 taggaattgattatgtttcagtagattcatatgaaaaaacttcagtatgaactcacatgtctttccaattcttcactgctttcttgcagttttgctttta 32852880  T
200 ataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaa 273  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32852879 ataccctgttgtatccacattattctgtagcagtgtctttcaatgatatttcttggttttttgccagtacaaaa 32852806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University