View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_low_34 (Length: 286)
Name: NF7489_low_34
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 2 - 279
Target Start/End: Complemental strand, 43066999 - 43066718
Alignment:
| Q |
2 |
tgatccctaaaattctgtttactcagttttcttaggaaacaaactgaattcaaccggcctttaatttt-gtcaatgaaaagaaaaagtattcaacccacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43066999 |
tgatccctaaaattctgtttactcagttttcttaggaaacaaactgtattcaaccggcctttaatttttgtcaatgaaaagaaaaagtattcaacccacg |
43066900 |
T |
|
| Q |
101 |
tgttatgcgaacttgggtatgaaaatgaaaactcatggtctataa---gttggcatattccaattggttgaaccgtttgacccctcacccaaacattaat |
197 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
43066899 |
tgctatgcgaacttgggtatgaaaatggaaactcatggtctataatacgttggcatattccaattggttgaaccgtttgccccctcatccaaacattaat |
43066800 |
T |
|
| Q |
198 |
catgcacnnnnnnnnaaggaagtattcatgcacttttatctacgtattaaatcaagtcatcacgtatatgagatattcttcg |
279 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43066799 |
catgcacttttttttaaggaagtattcatgcacttttatctacgtattaaatcaagtcatcacgtatatgagatattcttcg |
43066718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University