View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_low_38 (Length: 254)
Name: NF7489_low_38
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 235
Target Start/End: Complemental strand, 14620719 - 14620492
Alignment:
| Q |
8 |
ttggtgttgcaggtttctactactatgaaagacttgtgccatgatgtttttggggttgctaaagaaaagaaagaccctaaagaagtgaagaccaatagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14620719 |
ttggtgttgcaggtttctactactatgaaagacttgtgccatgatgtttttggggttgctaaagaaaagaaagaccctaaagaagtgaagaccaatagag |
14620620 |
T |
|
| Q |
108 |
gtatatatccctttttcagttttaggtattgcttaacatagcatgttctattcagtttttgcttttgagtcattgtttttgcattaagcgcgttcttttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14620619 |
gtatatatccctttttcagttttaggtattgcttaacatagcatgttctattcagtttttgcttttgagtcattgtttttgcattaagcgcattcttttc |
14620520 |
T |
|
| Q |
208 |
tgattctctgcttctttgggcagatctg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14620519 |
tgattctctgcttctttgggcagatctg |
14620492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 8 - 235
Target Start/End: Original strand, 17709477 - 17709704
Alignment:
| Q |
8 |
ttggtgttgcaggtttctactactatgaaagacttgtgccatgatgtttttggggttgctaaagaaaagaaagaccctaaagaagtgaagaccaatagag |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17709477 |
ttggtgttgtaggtttctactactatgaaagacttgtgccatgatgtttttggggttgctaaagaaaagaaagaccctaaagaagtgaagaccaatagag |
17709576 |
T |
|
| Q |
108 |
gtatatatccctttttcagttttaggtattgcttaacatagcatgttctattcagtttttgctttt-gagtcattgtttttgcattaagcgcgttctttt |
206 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| || ||| ||||||||||||||||| |||||||| |
|
|
| T |
17709577 |
gtatatacccctttttcagttttatgtattgcttaacatagcatgttctattcagttattgcttttcgattca-tgtttttgcattaagcgtgttctttt |
17709675 |
T |
|
| Q |
207 |
ctgattctctgcttctttgggcagatctg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17709676 |
ctgattctctgcttctttgggcagatctg |
17709704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University