View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_low_48 (Length: 234)
Name: NF7489_low_48
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 26727146 - 26726940
Alignment:
| Q |
15 |
aatatagtttctcatcataatttcaacaa---aataaagatgggtttctctaatggatactatctacgagttaaacaaacacttatatacaaagaattgt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26727146 |
aatatagtttctcatcataatttcaacaacaaaataaagatgggtttctctaatggatactatctacgagttaaacaaacacttatatacaaagaattgt |
26727047 |
T |
 |
| Q |
112 |
gttcaagaaaggtgttttcatcattcttttgttttaataaatttcatttgttgcttgaccattggatgacannnnnnnccattaccaattatctacgtta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26727046 |
gttcaagaaaggtgttttcatcattcttttgttttaataaatttcatttgttgcttgaccattggatgacatttttttccattaccaattatctacgtta |
26726947 |
T |
 |
| Q |
212 |
tcttttt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
26726946 |
tcttttt |
26726940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University