View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7489_low_50 (Length: 223)
Name: NF7489_low_50
Description: NF7489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7489_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 123 - 214
Target Start/End: Original strand, 26966451 - 26966543
Alignment:
| Q |
123 |
agtcataactttgattt-aaaaagatagatagatgacagtagtaggttttgggcatcccaattcaaataacagatccaattgtctctgctact |
214 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26966451 |
agtcataactttgattttaaaaagatggatagatcacagtagtaggttttgggcatcccaattcaaataacagatccaattgtctttgctact |
26966543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 26966338 - 26966372
Alignment:
| Q |
19 |
tttatctattgtgcaatacaatgataatgacattt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
26966338 |
tttatctattgtgcaatacaatgataataacattt |
26966372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University