View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7490_high_6 (Length: 348)
Name: NF7490_high_6
Description: NF7490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7490_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 93 - 215
Target Start/End: Complemental strand, 24040681 - 24040560
Alignment:
| Q |
93 |
tcgtctgtaatgtttaccttttgtgtgatgtttgcttgtgcaagagacatgatgatgtatgtgcaatgttaatgcctaaataaaataagtaaatcgcttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24040681 |
tcgtctgtaatgtttaccttttgtgtgatgtttgcttgtgcaagagacatgatgatgtatgtgcaatgttaatgcctaaat-aaataagtaaatcgcttt |
24040583 |
T |
|
| Q |
193 |
aaatagttgttgatcttcttaat |
215 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24040582 |
aaatagttgttgatcttcttaat |
24040560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 24040802 - 24040710
Alignment:
| Q |
1 |
cactgtcactgtccctaaggaagaagttaagaagcctcaagtgaagaccattgatatctctggttaaactcagaacaagcttagttactctgt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
24040802 |
cactgtcactgtccctaaggaagaagttaagaagcctcaagtgaagaccattgatatctctggttaaactcggaacaaatttagttactctgt |
24040710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 3 - 90
Target Start/End: Original strand, 35107116 - 35107203
Alignment:
| Q |
3 |
ctgtcactgtccctaaggaagaagttaagaagcctcaagtgaagaccattgatatctctggttaaactcagaacaagcttagttactc |
90 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||| || ||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35107116 |
ctgtcactgtccctaaggaagagatcaagaagcctgaagtcaaagccattgaaatctctggttaaactcagaacaagctttgttactc |
35107203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 36935904 - 36935858
Alignment:
| Q |
20 |
gaagaagttaagaagcctcaagtgaagaccattgatatctctggtta |
66 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36935904 |
gaagaggttaagaagcctgaagtgaagaccattgatatctctggtta |
36935858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University