View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7490_low_14 (Length: 228)
Name: NF7490_low_14
Description: NF7490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7490_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 12124522 - 12124722
Alignment:
| Q |
15 |
atcacttttggaattatatgtttgtattcttctggtgggtcgaatggtatgattctgattcttttccagaaaggggtttctaagtcggcatgctctgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12124522 |
atcacttttggaattatatgtttgtattcttctggtgggtcgaatggtatgattctgattcttttccagaaaggggtttctaagtcggcatgctctgtca |
12124621 |
T |
 |
| Q |
115 |
tatcattcctgtttcaaaaaggtgaattttgcaaaccacatactcattattatatctgcaaaattac--gtgtgtttggttatacggtgaaaataattga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12124622 |
tatcattcctgtttcaaaaaggtgaattttgcaaaccacatactcattattatatcagcaaaattacgtgtgtgtttggttatacggtgaaaataattga |
12124721 |
T |
 |
| Q |
213 |
t |
213 |
Q |
| |
|
| |
|
|
| T |
12124722 |
t |
12124722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 37531749 - 37531781
Alignment:
| Q |
181 |
cgtgtgtttggttatacggtgaaaataattgat |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
37531749 |
cgtgtgtttggttatacggtgaaaaaaattgat |
37531781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University