View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7490_low_9 (Length: 252)
Name: NF7490_low_9
Description: NF7490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7490_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 46452832 - 46453053
Alignment:
| Q |
15 |
aatataaatattattctcttattgtcttccccaaaacaaaacaagataaactagtacatgtgactaggtctggtctggtgatgatataagtagttttgta |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46452832 |
aatataaatattatactcttattgtcttccccaaaacaaaacaagataaactagtagatgtgactaggtctggtctggtgatgatataagtagttttgta |
46452931 |
T |
 |
| Q |
115 |
ttgag-ctttggtgtactttatgtccatttaattctagtacgttagtgtcttgctactctcgatcccctccttccatcatggagattatttgccccgctc |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46452932 |
ttgaggctttggtgtactttatgtccatttaattctagtacgttagtgtcttgctactctcgatcccctccttccatcatggagattatttgccccgctc |
46453031 |
T |
 |
| Q |
214 |
ccccaatcgactggtttagagc |
235 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
46453032 |
ccccaatcaactggtttagagc |
46453053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University