View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7491_high_1 (Length: 266)
Name: NF7491_high_1
Description: NF7491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7491_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 27099316 - 27099081
Alignment:
| Q |
13 |
cagagagagagaaaataataaataaaaacaatggaaggaggaggaatgttatcatcttcatcatcacattcacaaaactatatctacagagagtgtttaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099316 |
cagagagagagaaaataataaataaaaacaatggaaggaggaggaatgttatcatcttcatcatcacattcacaaaactatatctacagagagtgtttaa |
27099217 |
T |
 |
| Q |
113 |
gaaaccatgcagcaagccttggaagctacgccaccgacggctgcggtgaattcaccatcgatgactcatcgccatccgcggtaaacagcctccaatgtgc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099216 |
gaaaccatgcagcaagccttggaagctacgccaccgacggctgcggtgaattcaccatcgacgactcatcgccatccgcggtaaacagcctccaatgtgc |
27099117 |
T |
 |
| Q |
213 |
agcctgcggctgtcaccggaacttccaccgcaaaat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099116 |
agcctgcggctgtcaccggaacttccaccgcaaaat |
27099081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University