View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7492_low_10 (Length: 428)
Name: NF7492_low_10
Description: NF7492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7492_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 410
Target Start/End: Original strand, 17107399 - 17107804
Alignment:
| Q |
1 |
cttccaaatgcaccataacaccactgcgattttgctctatatcttactctgcaagttaatgattttcattaaaattacaatcattatcactatccctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107399 |
cttccaaatgcaccataacaccactacgattttgctctatatcttactctgcaagttaatgattttcattaaaattacaatcattatcactatccctgaa |
17107498 |
T |
 |
| Q |
101 |
aaggaatatatagccttgtgatttagccaaaaggtacgtacaacttcgcttaaggtggaagaactccgtgcaaagctacaaagtttgtggaagtttattg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17107499 |
aaggaatatataaccttgtgatttagccaaaaggtac----aacttcgcttaaggtggaagaactc--tgcaaagctacaaagtttgtggaagtttattg |
17107592 |
T |
 |
| Q |
201 |
gcaagtagaggattacctcaccaggtaaaggtttttatgaacgttcattctctgcggtggaagatcttcaaagtatccaatcagtgcattcatggaacat |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17107593 |
gtaagtagaggattacctcaccaggtaaaggtttttatgaacgttcattctctgcggtggaagatcttcgaagtatccaatcagtgcattcatggaacat |
17107692 |
T |
 |
| Q |
301 |
caacgtcagttatct--aactctttacgtggagtgaggttttaaacctaacttgtaacatcaaatcagaccacagggctggatctgcatatctggaattg |
398 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
17107693 |
caacctcagttatcttaaactctttacgtggagtgaggttttatacctaacttgcaacatcaaaccagttcacagggctggatcagcatatctggaattg |
17107792 |
T |
 |
| Q |
399 |
atcaggagtatt |
410 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17107793 |
atcaggagtatt |
17107804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University