View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7492_low_13 (Length: 356)
Name: NF7492_low_13
Description: NF7492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7492_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 177 - 337
Target Start/End: Complemental strand, 17107219 - 17107059
Alignment:
| Q |
177 |
tgaaaaactcaaaatcggtgcaaaggtcgatgagataattggaagccgatgcaaatcaatgacaaccttgaagttgaagcagagccattaataatatgat |
276 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107219 |
tgaaaaacacaaaattggtgcaaaggtcgatgagataattggaagccgatgcaaatcaatgacaaccttgaagttgaagcagagccattaataatatgat |
17107120 |
T |
 |
| Q |
277 |
ggaaactagtttctactcctgcaagattatctggaccaactgaactgctaacaactttttc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107119 |
ggaaactagtttctactcctgcaagattatctggaccaactgaactgctaacaactttttc |
17107059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 9 - 180
Target Start/End: Complemental strand, 17107421 - 17107249
Alignment:
| Q |
9 |
tggtgttatggtgcatttggaagaggataaatgaacaaatgtcgaaggacgatgcaaaacaaattcaaacatatttaacaggc-gttgattttcttgaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17107421 |
tggtgttatggtgcatttggaagaggataaatgaacaaatgtcgaaggacgatgcaaaacaaattcaaacatatttaacaggcacttgattttcttgaca |
17107322 |
T |
 |
| Q |
108 |
attgggagtcgacaaaccagaggaaacacgtaatttttcctttaatggttgagggtggttaagatagaatgaa |
180 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107321 |
actgggagtcggcaaaccagaggaaacacgtaatttttcctttaatggttgagggtggttaagatagaatgaa |
17107249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University