View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7492_low_18 (Length: 253)
Name: NF7492_low_18
Description: NF7492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7492_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 39022193 - 39022390
Alignment:
| Q |
1 |
cgttggaagagtcccgtgatgggctttgtacgtagtaaactgcacgaagcccatcacgtgatcttgtcggtgaggattgtgttaggctgcttacctcgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39022193 |
cgttggaagagtcccgtgatgggctttgtacgtagtaaactgcacgaagcccatcacgtgatcttgtcggtgaggattgtgttaggctgcttacctcgga |
39022292 |
T |
 |
| Q |
101 |
gtctgtcttggctaacattgtaatggtgttgttgttgttttctggtttcattgttgatgtgaattttgagtttggnnnnnnngagaaagagaagagtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
39022293 |
gtctgtcttggctaacattgtaatggtggtgttgttgttttctggtttcattgttgatgtgaagtttgagtttggaaaaaaagagaaagagaagagtt |
39022390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 39022411 - 39022463
Alignment:
| Q |
184 |
agaaagagaagagttattgttagtgtaattggtgtatgagtggatgcagaaga |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39022411 |
agaaagagaagagttattgttagtgtaattggtgtatgagtggatgcagaaga |
39022463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University