View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7492_low_9 (Length: 465)
Name: NF7492_low_9
Description: NF7492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7492_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 3 - 447
Target Start/End: Original strand, 51367446 - 51367890
Alignment:
| Q |
3 |
tgggtacattattctggacttagttttagttttcattaacgttgattttctctgcatggagaggtttctctcaaacgaagcattcgaggaacacctcaaa |
102 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367446 |
tgggtccattaatctggacttagttttagttttcattaacgttgattttctctgcatggagaggtttctctcaaacgaagcattcgaggaacacctcaaa |
51367545 |
T |
|
| Q |
103 |
acctcacaatcaccaccaccatgacccgccggtgatggagaacgacgacggtcgtgattagggggttgtggaggccgggcatactcacccattgacggcg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51367546 |
acctcacaatcaccaccaccatgacccgccggtgatggagaacgacgacggtcgtgattagggggttgtggaggccgggcatactcacccattgaaggcg |
51367645 |
T |
|
| Q |
203 |
agtctttgctgtgtcttctccgaacaggatcgttcaccacggcatcaataccattcgaattagaagctggttcctcgaaacttactttcaactcgcgttg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367646 |
agtctttgctgtgtcttctccgaacaggatcgttcaccacggcatcaatcccattcgaattagaagctggttcctcgaaacttactttcaactcgcgttg |
51367745 |
T |
|
| Q |
303 |
aataaccgtgggagattcctcaaccggcgttaactttccgtcagcgccattaccttcattctgcagctcttccatctccaaatccatatccaacaacata |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367746 |
aataaccgtgggagattcctcaaccggcgttaactttccgtcagcgccattaccttcattctgcagctcttccatctccaaatccatatccaacaacata |
51367845 |
T |
|
| Q |
403 |
tcaccggaggcacgctgtttatgaagaaattttccgattagttgc |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367846 |
tcaccggaggcacgctgtttatgaagaaattttccgattagttgc |
51367890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University