View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7494_high_37 (Length: 334)
Name: NF7494_high_37
Description: NF7494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7494_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 6 - 319
Target Start/End: Original strand, 34120354 - 34120667
Alignment:
| Q |
6 |
actgaaatgaaggtggtataaaagttggttgttgcacattaaaatcataaatttccttccagtccctaacattttttgtatgctctgcttcaaaatatcc |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120354 |
actgaaaagaaggtggtataaaagttggttgttgcacattaaaatcataaatttccttccagtccctaacattttttgtatgctctgcttcaaaatatcc |
34120453 |
T |
|
| Q |
106 |
aagcaagttaacttcatctcttctcaccttaatcttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatccaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120454 |
aagcaagttaacttcatctcttctcactttaaccttctcttccaaactaagttcaaaaaatttgtttgcagattcttcaattctctcacgtttatccaaa |
34120553 |
T |
|
| Q |
206 |
ggcactttgtgattaataacttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagttttggatggaaagtgagttggtttcatcat |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34120554 |
ggcactttgtgattaataacttgaaagaaaccccattctttacatgcttgaccaatttctttgaccaagttttcgatggaaagtgagttggtttcatcat |
34120653 |
T |
|
| Q |
306 |
cttggtagtttatg |
319 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34120654 |
cttggtagtttatg |
34120667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University