View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7494_low_24 (Length: 411)
Name: NF7494_low_24
Description: NF7494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7494_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 74 - 351
Target Start/End: Original strand, 21641453 - 21641729
Alignment:
| Q |
74 |
cacacaaaccgttactcttcaaatttcaagataccatcctcttctttagttttctatattcatcttctagtggatttcaattacaatctcaaagattagt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21641453 |
cacacaaaccgttactcttcaaatttcaagataccatcctcttctttagttttctatattcatcttctagtggatttcaattacaatctcaaagattagt |
21641552 |
T |
 |
| Q |
174 |
gattgaaaaatttggttagattttgttgaactttagtttccttttgcaaatttgtgattgtaatcatggttttaaattgtggtctgctacgataatataa |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| | ||||||| |||||||||| |
|
|
| T |
21641553 |
gattgaaaaatttggttagattttgttgaactttactttccttttgcaaatttgtgattgcaatcatggttttaaattgcgatctgctaagataatataa |
21641652 |
T |
 |
| Q |
274 |
agaattttgaggtttctgtaatagcatcgtagccgcaatttcaaaccatgattgcaatgaagcctgtacgagaggcct |
351 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||| ||| ||||||||||| |||| | || ||||||||| |
|
|
| T |
21641653 |
agaattttgaggtct-tgcaatagcatcgtagccgcaattttaaattatgattgcaattaagcttatatgagaggcct |
21641729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 21641386 - 21641432
Alignment:
| Q |
6 |
agaacctgtgacatacattataattt-cgtgcctacttttccacttg |
51 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21641386 |
agaacatgtgacatacattataattttcgtgcctacttttccacttg |
21641432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University