View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7494_low_27 (Length: 385)
Name: NF7494_low_27
Description: NF7494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7494_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 29473473 - 29473845
Alignment:
| Q |
1 |
aaacaagaagaatagtaactagtttgtttatgctactttgctgtaaagtagtgtaacacaatatggagttgactcaataatcatgatcatatatttcacg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473473 |
aaacaagaacaatagtaactagtttgtttatgctactttgctgtaaagtagtgtaacacaatatggagttgactcaataatcatgatcatatatttcacg |
29473572 |
T |
 |
| Q |
101 |
gtttatctaaactttttcatgctctcatcaatcaaagtttatagctttactttctctctcttatttatctatctgttgtgtattcattgttttcatgggt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29473573 |
gtttatccaaactttttcatgctctcatcaatcaaagtttatagctttactttctctctcttatttatctctctgttgtgtattcattgttttcatgggt |
29473672 |
T |
 |
| Q |
201 |
ctatttaatttttctcctaaccaaaagggtcatttcatttctttaacaacacggtatcttttgtttttatttcaattttctatgtcatcttctgttatgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473673 |
ctatttaatttttctcctaaccaaaagggtcatttcatttctttaacaacacggtatcttttgtttttatttcaattttctatgtcatcttctgttatgt |
29473772 |
T |
 |
| Q |
301 |
cttgaacttctcaattttctcatgttcacacacactatatgtgtttagcttctgttcttgtcaagtatttgatg |
374 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29473773 |
cttgaacttctcaatttt-tcatgttcacacacactatatgtgtttagcttctgttcttgtcaagtatttgatg |
29473845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University