View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7494_low_55 (Length: 252)
Name: NF7494_low_55
Description: NF7494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7494_low_55 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 7666119 - 7665877
Alignment:
| Q |
10 |
aataatatccatagtaacatcttcccatacctgagtgggtattggtagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacag |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666119 |
aataaaatccatagtaacatcttcccatacctgagtgggtattggcagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacag |
7666020 |
T |
|
| Q |
110 |
atcagacattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666019 |
atcagacattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgcc |
7665920 |
T |
|
| Q |
210 |
ctccaatcggtgaagcatgaaactcttgcaacacttgttggat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665919 |
ctccaatcggtgaagcatgaaactcttgcaacacttgttggat |
7665877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University