View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7494_low_63 (Length: 229)
Name: NF7494_low_63
Description: NF7494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7494_low_63 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 26569459 - 26569229
Alignment:
| Q |
7 |
gagatgaatggaactgaggtatactttatttatattacgtcccaatttttacatttatatataactatgcatgcacgagttcattcttgtgttttatttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26569459 |
gagatgaatggaactgaggtatactttatttatattacatcccaatttttacatttatatataagtatgcatgcacgaattcattcttgtgttttatttt |
26569360 |
T |
 |
| Q |
107 |
tgttataaaagaaaatatatgcatgcatg--------catgagttcattcttgtctttttatttgtttattatataggcaacaaagcaactacgcttgat |
198 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26569359 |
tgttatagaagaaaatatatgcatgcatgcatgcatgcatgagttcattcttgtctttttatgtgtttattatataggcaacaaagcaactacgcttgat |
26569260 |
T |
 |
| Q |
199 |
ggggatatctagcaccattgttggtgtatct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26569259 |
ggggatatctagcaccattgttggtgtatct |
26569229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University