View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7495_high_16 (Length: 216)
Name: NF7495_high_16
Description: NF7495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7495_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 54803418 - 54803599
Alignment:
| Q |
19 |
aaaattttatagcatgattatacgggcaaatgaaattgacgaaaccatggtgacaccataatattgttatagctctaaagttgaataaaaaatatcactc |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803418 |
aaaattttatagcatgattatatgggcaaatgaaattgacgaaaccatggtgacaccataatattgttatagctctaaagttgaataaaaaatatcactc |
54803517 |
T |
|
| Q |
119 |
aatattttttagattagaatattatgatagatacccctnnnnnnntattatgatagatgtgttgggtatagaataagatatg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803518 |
aatattttttaaattagaatattatgatagatgcccctaaaaaaatattatgatagatgtgttgggtatagaataagatatg |
54803599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University