View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7495_high_5 (Length: 368)
Name: NF7495_high_5
Description: NF7495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7495_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 17 - 356
Target Start/End: Complemental strand, 35505894 - 35505555
Alignment:
| Q |
17 |
gttgttttgttgtaaccatccacttgttggctgttgttggggaggtggtggttctgaggacgacgattttgattctcctcatctcttccggttcttcctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505894 |
gttgttttgttgtaaccatccacttgttggctgttgttgtggaggtggtggttctgaggacgaagattttgattctcctcatctcttccggttcttcctt |
35505795 |
T |
|
| Q |
117 |
gagccagaagaatcaaacaattagccatgtctgcttcctcttcatgctcagtgtcatcgaaggtggtggatgaaaacgatccaccacctccagtggcact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505794 |
gagccagaagaatcaaacaattagccatgtctgcttcctcttcatgctcagtgtcatcgaaggtggtggatgaaaacgatccaccacctccagtggcact |
35505695 |
T |
|
| Q |
217 |
tgagcaacttgatgtcatcgtagcagttgccacggtgacaggagacagctgccttaaccgtttcgttcgctttcctttgatgagatgcccggcatcatta |
316 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505694 |
tgagcagcttgatgtcatcgtagcagttgccacggtgacaggagacaattgccttaaccgtttcgttcgctttcctttgatgagatgcccggcatcatta |
35505595 |
T |
|
| Q |
317 |
ccatgttcttcacttcttattattccttccatgttcattt |
356 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35505594 |
ccatgttcttcacttcctattattccttccatgtccattt |
35505555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University