View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7495_low_13 (Length: 293)
Name: NF7495_low_13
Description: NF7495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7495_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 17540745 - 17541019
Alignment:
| Q |
19 |
gtagtttaggtggaacccaattccctagtctccttgcaacactttgtttcgtgcatcgtcttgtattgtgaccaagtaatccacactttaagcattgggg |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17540745 |
gtagtttaggtggaacccaattccttagtctccttgcaacactttgtttcgtgcatcgacttgtattgtgaccaagtaatccacactttaagcattgggg |
17540844 |
T |
 |
| Q |
119 |
ttcattgtttgatttcttcatgttatggccattgacaggttcctcgttgccatcctttcttcttcgttttttgggtcttctggtatctctcttcctcttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17540845 |
ttcattgtttgatttcttcatgttatggccattgacaggttcctcgtcgccatcctttcttcttcgttttttgggtcttccggtatctctcttcctcttc |
17540944 |
T |
 |
| Q |
219 |
gcggagggtttcctacaagtggagagtttactacaagtatgatttggaacatatgttttaacttggaaacatttt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17540945 |
gcggagggtttcctacaagtggagagtttactacaagtatgatttggaacatatgttttaacttggaaacatttt |
17541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University