View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7499_low_2 (Length: 251)
Name: NF7499_low_2
Description: NF7499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7499_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 234
Target Start/End: Original strand, 51154238 - 51154461
Alignment:
| Q |
10 |
aagaatataaacaataaccatcaaagtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttctttaggcgcctaggattctt |
109 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51154238 |
aagaaaataaacaataaccatcaa-gtatgagatatcgattctatttcagtatagtgtaaatgtaatttcaaaattgttctttaggcgcctaggattctt |
51154336 |
T |
|
| Q |
110 |
cataagcacatcaagccctaaacttcactgatagataactacagtccgcaagtgaacggtagttaagaaccattcactactttttaaatcggttaatcgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51154337 |
cataagcacatcaagccctaaacttcactgatagataactacagtccgcaagtgaacggtagttaagaaccattcactactttttaaatcggttaatcgg |
51154436 |
T |
|
| Q |
210 |
gtaactgatctaaaatgtattatgt |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
51154437 |
gtaactgatctaaaatgtattatgt |
51154461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University