View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7500_high_2 (Length: 241)
Name: NF7500_high_2
Description: NF7500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7500_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 32178948 - 32179036
Alignment:
| Q |
1 |
ttgttttgtatacgtgctggttttttatgggttaagttaacggtggtgggtcagagagagtgtaattgttggtggaagcgttaccgacattc |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32178948 |
ttgttttgtatacgtgctggttttttatgggttaagttaacggtggtgggtcagagagagtgtaattgt---tggaagcgttaccgacattc |
32179036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 156 - 231
Target Start/End: Original strand, 32179100 - 32179179
Alignment:
| Q |
156 |
cattcagtagcttttcaatttcaaaagtaaacttttta----ttctttattcatgtaataatagtttaatggctgtacaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32179100 |
cattcagtagcttttcaatttcaaaagtaaactttttacttattctttattcatgtaataatagtttaatggctgtacaa |
32179179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University